Сетевое издание
Международный студенческий научный вестник
ISSN 2409-529X

ИСПОЛЬЗОВАНИЕ МИКРОСАТЕЛЛИТНОГО ПОЛИМОРФИЗМА У СТРАУСОВОДСТВЕ

Осадчая Ю.В. 1 Жало В. 1
1 Национальный университет биоресурсов и природопользования Украины
В статье обобщены литературные данные касательно микросателлитного полиморфизма у страусов и его использования для построения генетической карты. Исследователями Китайского аграрного университета было исследовано 150 голов страусов по 30 микросателлитам. На один локус приходилось число аллелей от 5 на локус CAU78 до 34 на локус CAU85. Значения наблюдаемой гетерозиготности колебалось от 0,467 (локус CAU78) до 0,993 (локус CAU16), в то время как для ожидаемой гетерозиготности – от 0,510 (локус CAU78) до 0,953 (локус CAU85). Наивысший индекс полиморфизма (PIC) наблюдался по локусам CAU85 (0,932), CAU64 (0,861) и CAU32, 75 (0,852), соответственно. Микросателлитные маркеры, используемые в исследовании, были очень полиморфны, о чем свидетельствует большое количество обнаруженных аллелей и высоким уровнем гетерозиготности.
микросателлиты
полиморфизм
страусы
генетическая карта
1. Botstain D. Construction of a linkage map in man using restriction fragment length polymorphism / Botstain D., White R.L., Skolnick M., Dawid R.W.// Am J Hum Genet. – 1980. – Vol.32. – p.314–331.
2. Cooper R.G. Ostrich nutrition: a review from a Zimbabwean perspective / Cooper R.G., Horbańczuk J.O. // Rev Sci Tech Off Int Des Epizoot. – 2004. – Vol. 23. – p.1033–1042.
3. Cooper R.G. Nutrition and feed management in the ostrich (Struthio camelus domesticus) / Cooper R.G., Horbańczuk J.O., Fujhara N. // Anim Sci J. – 2004. – Vol. 75. – p. 175–181.
4. Cooper R.G. Avian influenza in ostriches (Struthio camelus) / Cooper R.G., Tomasik C., Horbańczuk J.O. // Avian Poult Biol Rev. – 2007. – Vol. 18. – p. 87–92.
5. Cooper R.G. Sex-based comparison of limb segmentation in ostriches aged 14 months with and without tibiotarsal rotation / Cooper R.G., Naranowicz H., Maliszewska E., Tennett A., Horbańczuk J.O. // J S Afr Vet Assoc. – 2008. Vol. 79. – p.142–144.
6. Davids A.H. Estimation of genetic distances and heterosis in three ostrich (Struthio camelus) breeds for the improvement of productivity / Davids A.H. // Master Thesis, Stellenbosch University. – 2011. – 523 p.
7. Gortari M.J. A second-generation linkage map of the sheep genome / Gortari M.J., Freking B.A., Cuthbertson R.P., Kappes S.M., Keele J.W., Stone R.T., Leymaster K.A., Dodds K.G., Crawford A.M., Beattie C.W. // Mamm Genome. – 1998. Vol.9. – p. 204–209.
8. Groenen M.A. A consensus linkage map of the chicken genome / Groenen M.A., Cheng H.H., Bumstead N., Benkel B.F., Briles W.E., Burke T., Burt D.W., Crittenden L.B., Dodgson J., Hillel J., Lamont S., Leon A.P., Soller M., Takahashi H., Vignal A. // Genome Res. – 2000. Vol.10. – p. 137–147.
9. Groenen M.A. A comprehensive microsatellite linkage map of the chicken genome / Groenen M.A., Crooijmans R.P., Veenendaal A., Cheng H.H., Siwek M., Poel J.J. // Genomics. – 1998. Vol. – 49. – p. 265–274.
10. Hammond E.L. Microsatellite analysis of genetic diversity in wild and farmed emus (Dromaius novaehollandiae) / Hammond E.L., Lymbery A.J., Martin G.B., Gtoth D., Wetherall J.D. // J Hered. – 2002. – Vol. 93. – p. 376–380.
11. Horbańczuk J.O. A serach for sequence similarity between chicken (Gallus domesticus) and ostrich (Struthio camellus) microsatellite markers / Horbańczuk J.O., Kawka M., Sacharczuk M., Cooper R.G., Boruszewska K., Parada R., Jaszczak K. // Anim Sci Pap Rep.– 2007. Vol. 25. – p. 283–288.
12. Horbańczuk J. Cholesterol content and fatty acid composition of ostrich meat as influence by subspecies / Horbańczuk J., Sales J., Celeda T., Konecka A., Zieba G., Kawka P. // Meat Sci. – 1998. Vol. 50. – p. 385–388.
13. Horbańczuk J.O. Ostrich farming in Poland—its history and current situation after accession to the European Union / Horbańczuk J.O., Tomasik C., Cooper R.G. // Avian Poult Biol Rev. – 2008. Vol. – 1. – p. 65–71.
14. Huang Y. A preliminary microsatellite genetic map of the ostrich (Struthio camelus) / Huang Y., Liu Q., Tang B., Lin L., Liu W., Zhang L., Li N., Hu X. // Cytogenet Genome Res. – 2008. – Vol. 121. – p. 130–136.
15. Kalinowski S.T. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment / Kalinowski S.T., Taper M.L., Marshall T.C. // Mol Ecol. – 2007. – Vol. –16. – p. 1099–1106.
16. Kappes S.M. A second-generation linkage map of the bovine genome / Kappes S.M., Keele J.W., Stone R.T., McGraw R.A., Sonstegard T.S., Smith T.P., Lopez-Corrales N.L., Beattie C.W. // Genome Res. – 1997. – Vol. 7. – p. 235–249.
17. Kawka M. Genetic characteristics of the ostrich population using molecular methods / Kawka M., Horbańczuk J.O., Sacharczuk M., Zięba G., Łukaszewicz M., Jaszczak K., Parada R. // Poult Sci. – 2007. – Vol. 86. – p. 277–281.
18. Kawka M. Identification of genetic markers associated with laying production in ostriches (Struthio camelus)–a preliminary study / Kawka M., Sacharczuk M., Cooper R.G. // Anim Sci Pap Rep. –2010. – Vol. 28. – p. 95–100.
19. Kimwele C.N. molecular genetic analysis of the communal nestin of the ostrich (Struthio camelus) Kimwele C.N., Graves J.A. / Kimwele C.N., Graves J.A. // Mol Ecol. – 2003. – Vol. 12. – p. 229–236.
20. Ott J. Strategies for characterizing highly polymorphic markers in human gene mapping / Ott J. // Am J Hum Genet. – 1992. – Vol. 51. – p. 283–290.
21. Rohrer G.A. A comprehensive map of the porcine genome / Rohrer G.A., Alexander L.J., Hu Z., Smith T.P., Keele J.W., Beattie C.W. // Genome Res. – 1996. – Vol. 6. – p. 371–391.
22. Sales J. Ratite Meat / Sales J., Horbańczuk J.O. // Worlds Poult Sci J. – 1998. – Vol. 54. – p. 59–67.
23. Sales J. Carcase characteristics of emus (Dromaius novaehollandiae) / Sales J., Horbańczuk J.O., Dingle J., Coleman R., Sensik S. // Br Poult Sci. – 1999. – Vol. 40. – p. 145–147.
24. Standing Committee of the European Convention for the protection of animals kept for farming purpose (T-AP) (1997) Draft Recommendation Concerning Ratites (Ostriches, Emus and Rheas). 33rd Meeting, Strasbourg, 22–25 April, 1997. – p. 1–16.
25. Tang B. Isolation and characterization of 70 novel microsatellite markers from ostrich (Struthio camelus) genome / Tang B., Huang Y.H. Lin L. Hu X.X., Feng J.D., Yao P., Zhang L., Li N. // Genome. – 2003. – Vol. 46. – p. 833–840.
26. Ward W.K. Ostrich microsatellite polymorphism at the VIAS-OS4, VIAS-OS8, VIAS-OS14, VIAS-OS22 and VIAS-OS29 loci / Ward W.K., McPartlan H.C., Matthews M.F., Murray N.D., Robinson N.A. // Anim Genet. – 1998. – Vol. 29. – 331 p.
27. Weir B.S. Genetic data analysis / Weir B.S. // Suderland: Sinauer Associates, 1990. – 145 p.
28. Zhou X. A study of molecular genetic markers in ostrich breeding / Zhou X., Ning L., Lao Z., Qingwei C. // In: Proceedings of international conference on development of ostrich estate, Xian, 3–5 April, 2004. – p. 236–238.
Введение. В последние годы изучение молекулярной генетики внесло свой вклад в более глубокое признание использования генетической информации сельскохозяйственных животных. Это привело к созданию междисциплинарных программ геномов разных видов животных. Основной целью отображения генома животных является определение местоположение и расстояние между генами на хромосомах, а также для поиска генетических маркеров и определения качества продукции (локусы количественных признаков - QTL).  В наше время зарегистрировано несколько генетических карт в сельскохозяйственных животных, таких как свиньи [21], крупный рогатый скот [16], овцы [7] и куры [8, 9].

За последние несколько лет страусоводство набирает популярность во всем мире как новая отрасль сельскохозяйственной деятельности [2], так как от этих птиц можно получить диетическое мясо, ценные шкуры, перья и яйца [3, 4, 12, 22]. Нарастающий интерес к бескилевым птицам, особенно страусам и эму привел к увеличению спроса на информацию о них [5, 13, 23], а особенно их генетических аспектах [6, 11, 14, 17,18,19, 25, 26]. Эти исследования направлены на определение генетической структуры страусов, например, оценки генетической изменчивости и анализа взаимосвязи между особями, принадлежащими к данной популяции [28].

Данная статья  освещает ряд исследований, посвященных генетическому анализу популяции страусов с использованием молекулярных методов [17]. Полученные результаты могут быть использованы для тестирования генетического разнообразия и идентификации  новых микросателлитных последовательностей. Следующий этап исследований  должен включать изучение генома страусов, поскольку в настоящее время в доступной литературе есть нехватка данных о генетических картах сцепления для любых бескилевых. Однако, предварительная генетическая карта страуса разработана Хуанг и др. [14]. Ученые проанализировали 104  полиморфных микросателлитных маркеров с использованием двух поколений страусов.

Основная цель данного исследования заключалась в определении полиморфизма отдельных микросателлитных маркеров, характерных для страусов, так как микросателлитный полиморфизм широко используется в исследованиях по картографии генома.

Материалы и методы. Экспериментальный материал состоял из перьев, собранных из 150 страусов   страусиной фермы в Stypułów, на которой птиц содержат в условиях соответствующих  рекомендациям ЕС, Комитета Европейской конвенции о защите животных, содержащихся на фермах (T-AP) - Проект «Рекомендации по бескилевые (страусы, эму и нанду)» [24].

ДНК страусов ученые выделяли из перьев (не инвазивным методом) с помощью DNeasy Tissue KIT 250 из Quiagen. Каждый образец был осмотрен с помощью спектрофотометра и электрофореза. Анализировали 30 микросателлитных последовательностей [25]. Характеристика локусов представлена в таблице 1.

Усиление выбранных микросателлитных последовательностей проводили с использованием термоциклера PTC-200 (MJ Research). ПЦР проводили в общем объеме 10 мл, содержащих 10 нг матричной ДНК, 0,5 мМ каждого нуклеотида, 100 нмоль каждого праймера, 1,5 мМ MgCl2, 50 мМ KCl, 10 мМ Трис-HCl, 0,01% Tryton Х 100 и 0,5 единицы ДНК-полимеразы (POLGEN). Условия ПЦР были оптимизированы для всех 30 пар праймеров. Протокол ПЦР ставили с шагом денатурации в течение 5 мин при 94 °С, 35 циклов при 94 °С в течение 45 с, 52,5-69,5 °С в течение 45 с (отжиг) и при 72 °С в течение 90 с (расширение), с конечной стадией элонгации 10 мин при 72 °С.

Флуоресцентные ПЦР-продукты разделяли с помощью электрофореза с использованием четырех капилляров генетического анализатора Applied Biosystems 3130 и программного обеспечения GeneScan. Результаты были визуализированы и генотипированы  с использованием GeneScan 2.1. Кроме того, компьютерная программа GeneMapper (Applied Biosystems) была использована для автоматического определения размера аллеля для отдельных маркеров.

1. Характеристики 30 микросателлитных локусов страуса

Микросателлит

Последовательность

микросателлита

Повторение мотива

Количество аллелей

Длина аллелей

CAU1

TTACAAGCAAGGTAGAACCCA

(AC)8AT(GC)3(AC)7

10

86-104

GCAAGCAACCCAATCCCTG

CAU3

AACTAAGTATAGCCCTGTTACA

(CA)9

6

115-125

TGCGAGTCTTTCTAGTTCTAC

CAU7

CACTCCTGTCCCCTACTTG

(AC)18

12

185-211

CTGTAGTGTATTTAGAGACTGA

CAU11

CCTTGACAGTCTTCCCATATGAC

(CA)12

7

98-114

AACACAGAGGGCTTAGTCCTACA

CAU14

ATTTAACTTCTCTAAGGCACTC

(CA)16

14

142-178

GAGGAGCAATTCAGACAGAC

CAU16

TGTCCCTGCAGTCTCAGTTTT

(CA)27

7

188-204

GCCAGGTATGTGCATGTGTC

CAU17

CGTAAACCCAGATAATCACAA

(CA)22

11

160-180

AGTGGCATTGTAGCTCTTCA

CAU22

TGACTGTTAAATAAGCGAATGT

(AC)11

7

140-154

CATATATTAAGCCACTCTAAAAT

CAU23

AGGAACCGTGGAACACATTT

(CA)10

7

165-193

GAGCTGTGAACGTCTTCATCC

CAU25

ATGGGGCAGCATAAGAGTGT

(CA)5CT(CA)8

6

197-207

CCAGGTGAATTTGCCACATA

CAU30

AGGGGAGCGTTCTCACTCA

(CA)19

9

117-137

GCCACAAAGCAAAAGACCAC

CAU32

ATACTGGTTTTGATTTGTGTGAT

(CA)10

7

177-205

CATGGGAAGGGCAATAGATTT

CAU34

ATTTGATAGCCAGAGCAGTTC

(CA)12

7

194-208

TCTTACAAGATTTCACTATATACA

CAU40

ACGGGGAGACTCAAGGATG

(CA)9

9

138-156

GCTTGCGTGTGCATGAGTAT

CAU42

AGTCCAGCCCGCATACAC

(CA)10

7

182-198

CCTCTGTGGAGAGAACTGTGTG

CAU43

ACTGAGTGCCCAGGTTTGAG

(CA)17

6

211-221

TGCTGTTTCTTCTTCTTTTAGGG

CAU44

GCAAAGCAGTGTCCTTAGTCAA

(CA)12

5

227-237

AGCGTGTATCTGCCACATGA

CAU57

AAGAGGCAACAGGAATAGGTA

(CA)7(TA)5(CA)5

6

201-221

CAAAAATCTGGCTTGTCACTTA

CAU64

AGCACCTCATCCCTCAAAC

(CATA)7(CA)6(TA)4

9

161-183

AGATTTGGAGCATGGACTATT

(CA)15

CAU65

TGAGAGTCTCCCAGAAATGC

(TA)12(CA)9

6

181-191

CAGAGAAATATATGCCTGTAAAT

CAU68

TCTAAGCACTACCATCACGG

(TA)7(CA)8...(CA)15

6

265-275

GCTCCTTTTCATCTTTTAGGC

CAU69

TGAGTAAGGCATGCTGCTTC

(GA)19

6

100-112

CCTAAATGCAACCCTTCTGTTT

CAU75

ACAGACCAGGGAGTCCAGCA

(GC)7(AC)18

7

186-210

ACCCTGCACCTTGACAACAT

CAU76

GCACCAATCTTGATGTCCTG

(CA)11CG(CA)5

10

220-254

ACCTACCCAGAATGGCTTGA

CAU78

CAGGTGGAAAGTGGGTATGC

(AC)8C5

5

113-121

GCTTTGTAAGTGTGGGTGTGG

CAU83

AAACAAGCCGCTAGTGAGGA

(AC)16

8

198-218

TGCAGACTCAGACCAGCATC

CAU84

TATCAGTGCCATTATCGTCTC

(CA)12

7

202-214

TGTCCCTTCTGTTTCTAATACT

CAU85

GAGGTGCCTGTCTTGTTTAC

(AC)26

16

204-276

AAAAGCACCTTCCCACATTG

CAU97

TGCACGCACTAACTCCTGTC

(CA)10

5

152-166

AGTTCCCCTTCCAAATGCTT

CAU98

CACTCCACCGAATGCCTTTA

(CA)12

8

134-178

TTTGTTCAGGTGCAGAATGC

Статистический анализ полученных результатов проводили с использованием программы Cervus [15]. Она включала в себя: определение частоты выявленных аллелей, оценивание наблюдаемой и ожидаемой гетерозиготности, индекс полиморфизма  (PIC) и вероятность исключения случайного совпадения алеллей  (PE).

Наблюдаемая гетерозиготность Hо была оценена для всех микросателлитных локусов рассматриваемой популяции. Ожидаемая гетерозиготность He была рассчитана по формуле Отта [20] и Уир [27], PIC оценивалась по Botstain и др. [1].

Результаты и обсуждение. В целом по 30 микросателлитным локусам было идентифицировано  343 аллели. Наиболее полиморфными были локусы: CAU84, CAU32, CAU7, CAU75 и CAU76, характеризирующиеся наибольшим количеством аллелей. Число алеллей на один локус колебалось  от 5 по  локусу CAU78 до 34 по локусу CAU85. По каждому микросателлитному локусу изучено в среднем  11,43 аллелей. Хотя другими учеными [17], анализировавшими 5 микросателлитных локусов был идентифицирован 51 аллель. Число аллелей в этих исследованиях на локус колебалось от 5 (локус ВИА-OS22) до 16 аллелей (локус VIAS-OS29). Среднее число аллелей на локус составляло 10,2.

Аналогичное исследование на выделения и характеристику 70 новых микросателлитных маркеров  у страусов  провели Тан и др. [25]. Число аллелей, полученных ими, колебалось от 2 до 16, в среднем 5,6 по локусу. Тем не менее, в исследованиях Уорд и др. [26], число аллелей по локусу колеблется от 5 до 18 и в Kimwele и др. [19]  - от 6 до 25 аллелей.

На основании частоты отдельных аллелей исследуемых микросателлитных локусов оценили наблюдаемую гетерозиготность (Ho). Значения наблюдаемой гетерозиготности  колебалась от 0,467 по локусу CAU78 до 0,993 по локусу CAU16 (табл. 2). Значения ожидаемой гетерозиготности (Hе) колебалось в диапазоне от 0,510 по локусу CAU78 до 0,953 по локусу CAU85. Следует отметить, что оба значения (Ho и Hе) в исследуемой популяции страусов были относительно высокими. По данным Kimwele и др. [19] значение средней гетерозиготности  страусов, разводимых в  Национальном парке Найроби, а также содержащихся на фермах в Кении, колеблется от 0,40 до 0,79. В свою очередь, Kawka др. [17], рассматривая генетическую изменчивость внутри и между тремя подвидами страусов, определили, что наблюдаемая гетерозиготность   колеблется в пределах от 0,463 до 0,663, а ожидаемая - от 0,481 до 0,679.

Учеными также было исследовано генетическое разнообразие в популяциях эму, содержащихся на фермах в Австралии и Таиланде [10]. Всего было изучено 5 микросателлитных локусов. Следует отметить, что в обеих популяциях значение ожидаемой гетерозиготности  колебалось в широких пределах. Для страусов, разводимых на фермах  Австралии ожидаемая гетерозиготность составляла 0,44-1,0 в то время как для птицы, разводимой в Таиланде -  0,28-0,89.

2. Наблюдаемая (Ho) и ожидаемая (He) гетерозиготность страусов

Локус

Ho

He

Локус

Ho

He

CAU1

0,880

0,867

CAU43

0,913

0,836

CAU3

0,953

0,737

CAU44

0,860

0,688

CAU7

0,807

0,701

CAU57

0,713

0,832

CAU11

0,960

0,839

CAU64

0,893

0,876

CAU14

0,960

0,821

CAU65

0,700

0,820

CAU16

0,993

0,862

CAU68

0,780

0,850

CAU17

0,840

0,859

CAU69

0,967

0,840

CAU22

0,913

0,814

CAU75

0,867

0,869

CAU23

0,780

0,724

CAU76

0,873

0,853

CAU25

0,820

0,738

CAU78

0,467

0,510

CAU30

0,967

0,809

CAU83

0,833

0,781

CAU32

0,687

0,868

CAU84

0,833

0,841

CAU34

0,780

0,685

CAU85

0,953

0,939

CAU40

0,953

0,757

CAU97

0,853

0,754

CAU42

0,513

0,664

CAU98

0,900

0,722

В среднем

0,840

0,791

 

 

 

SE

0,023

0,018

 

 

 

Еще одним важным показателем, используемым для характеристики генетической изменчивости локуса, является индекс полиморфизма (PIC). Наибольшее значение для этого показателя, более 0,7, наблюдалось для локусов CAU85 (0,932), CAU64 (0,861) и CAU32, 75 (0,852) (табл. 3). Эти микросателлиты наиболее полиморфными и наиболее информативны при анализе генетических связей. Самые низкие значения (PIC=0,462) были характерны для локуса CAU78. Тогда как в предыдущем исследованиях, проведенных на страусах Kawka и др. [17], значение PIC располагалось в диапазоне от 0,117 до 0,786. Следует подчеркнуть, что почти все микросателлитные маркеры, выбранные для анализа были высокополиморфны или характеризовались высокими значениями индекса полиморфизма.

Среди наименее полиморфных микросателлитных маркеров можно отметить локус CAU78.

3. Индекс полиморфизма (PIC) и вероятность исключения случайного совпадения аллелей (PE) для микросателлитных локусов  страусов

Локус

PIC

PE

Локус

PIC

PE

CAU1

0,850

0,888

CAU43

0,812

0,841

CAU3

0,692

0,689

CAU44

0,642

0,637

CAU7

0,677

0,730

CAU57

0,812

0,857

CAU11

0,819

0,860

CAU64

0,861

0,905

CAU14

0,794

0,820

CAU65

0,792

0,815

CAU16

0,845

0,889

CAU68

0,828

0,859

CAU17

0,840

0,877

CAU69

0,818

0,852

CAU22

0,785

0,808

CAU75

0,852

0,895

CAU23

0,704

0,763

CAU76

0,834

0,876

CAU25

0,690

0,677

CAU78

0,462

0,446

CAU30

0,781

0,808

CAU83

0,756

0,797

CAU32

0,852

0,897

CAU84

0,818

0,846

CAU34

0,643

0,656

CAU85

0,932

0,972

CAU40

0,718

0,731

CAU97

0,719

0,743

CAU42

0,646

0,710

CAU98

0,689

0,720

Также была подсчитана  вероятность исключения случайного совпадения аллелей для каждого локуса (табл. 3).  Значение PE находились в диапазоне от 0,446 в локусе CAU78 в 0,972 на локус CAU85. Тогда как Kawka и др. [17] проанализировали пять микросателлитных локусов и получили очень высокую вероятность исключения случайного совпадения аллелей от 0,77 до 0,98. Анализ 30 микросателлитных представленных локусов дает очень высокую вероятность исключения неправильного происхождения - от 0,77 до 0,98. Представленные результаты показывают, что анализ этих 30 микросателлитных локусов может быть успешно применен в идентификации происхождения страусов, разводимых в Польше.

В целом, микросателлитные маркеры, используемые в  исследовании ученых, были очень полиморфны, о чем свидетельствует большое количество обнаруженных аллелей и высокий уровень гетерозиготности. Эти микросателлитные маркеры могут быть использованы для генетического картирования страусов а также построения сравнительных карт других бескилевых, таких как эму и нанду.


Библиографическая ссылка

Осадчая Ю.В., Жало В. ИСПОЛЬЗОВАНИЕ МИКРОСАТЕЛЛИТНОГО ПОЛИМОРФИЗМА У СТРАУСОВОДСТВЕ // Международный студенческий научный вестник. – 2015. – № 6. ;
URL: https://eduherald.ru/ru/article/view?id=13386 (дата обращения: 20.10.2021).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074